Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5113324
End position: 5113377
Length: 54

DNA sequence
>NC_022785, from 5113324 to 5113377 (54 bp); Streptomyces rapamycinicus NRRL 5491 GGGGTCGTCGGTCGGGCCAGGGTCGTCGGTCAAGCCGGGGTCGTCGGTCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5113372-5113971	Sequence	M271_20365 - hypothetical protein (Protein is coded in complementary strand; from 5113971 to 5113372)