Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5111705
End position: 5111749
Length: 45

DNA sequence
>NC_022785, from 5111705 to 5111749 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCCCGCGCGGGCTCTGCCGACTCGGGCTCTGCCGACTCGGGCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5111521-5111994	Sequence	M271_20355 - hypothetical protein (Protein is coded in complementary strand; from 5111994 to 5111521)