Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5007006
End position: 5007068
Length: 63

DNA sequence
>NC_022785, from 5007006 to 5007068 (63 bp); Streptomyces rapamycinicus NRRL 5491 CGGGGATTCCTGAGAAGTGGGCTGGGATTCCTGAGAAGTGGGGTGGGATTCCTGAGAAGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5006977-5008035	Sequence	M271_19860 - alpha/beta hydrolase (Protein is coded in complementary strand; from 5008035 to 5006977)