Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5005796
End position: 5005849
Length: 54

DNA sequence
>NC_022785, from 5005796 to 5005849 (54 bp); Streptomyces rapamycinicus NRRL 5491 CATCCGCTCACCGGACTGCATGCGCTCAGCCGACTGCATGCGTTCACCGGACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5005641-5005946	Sequence	M271_19850 - hypothetical protein (Protein is coded in complementary strand; from 5005946 to 5005641)