Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 499410
End position: 499439
Length: 30

DNA sequence
>NC_022785, from 499410 to 499439 (30 bp); Streptomyces rapamycinicus NRRL 5491 CGGCGCCGGCACCGGCACCGGCACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 499067-499786	Sequence	M271_02045 - teicoplanin resistance protein VanZ (Protein is coded in complementary strand; from 499786 to 499067)