Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4981631
End position: 4981666
Length: 36

DNA sequence
>NC_022785, from 4981631 to 4981666 (36 bp); Streptomyces rapamycinicus NRRL 5491 GTCCGGCGCGGCGTCCGCCTCGGCCTCCGGCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4981539-4982015	Sequence	M271_19755 - hypothetical protein (Protein is coded in complementary strand; from 4982015 to 4981539)