Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4973941
End position: 4973985
Length: 45

DNA sequence
>NC_022785, from 4973941 to 4973985 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGGCGGCTGGCCGTACTGCGGCTGGCCGTACTGCGGCTGGCCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4972466-4974316	Sequence	M271_19725 - hypothetical protein (Protein is coded in complementary strand; from 4974316 to 4972466)