Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4971520
End position: 4971549
Length: 30

DNA sequence
>NC_022785, from 4971520 to 4971549 (30 bp); Streptomyces rapamycinicus NRRL 5491 GCGGCGCGGTCCGGCGCGTCGCCGCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4971471-4972199	Sequence	M271_19720 - transcriptional regulator (Protein is coded in complementary strand; from 4972199 to 4971471)