Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4965263
End position: 4965298
Length: 36

DNA sequence
>NC_022785, from 4965263 to 4965298 (36 bp); Streptomyces rapamycinicus NRRL 5491 GCCCCACTGTGCGGCCCACTGTGCGCCCCGCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4964711-4965568	Sequence	M271_19690 - transcriptional regulator (Protein is coded in complementary strand; from 4965568 to 4964711)