Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4917743
End position: 4917769
Length: 27

DNA sequence
>NC_022785, from 4917743 to 4917769 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGCTGCGGGCGCTGCGGGCGCCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4916807-4917997	Sequence	M271_19470 dppD peptide ABC transporter ATP-binding protein