Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4904449
End position: 4904502
Length: 54

DNA sequence
>NC_022785, from 4904449 to 4904502 (54 bp); Streptomyces rapamycinicus NRRL 5491 CGGCCGACGGCTCCTTCGCGGCGGTCGGCTCGTTCGCGGCGGTCGGCTCGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4904148-4906748	Sequence	M271_19420 - histidine kinase (Protein is coded in complementary strand; from 4906748 to 4904148)