Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4901799
End position: 4901822
Length: 24

DNA sequence
>NC_022785, from 4901799 to 4901822 (24 bp); Streptomyces rapamycinicus NRRL 5491 TGGTGGTGGTGCTCGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4900950-4901831	Sequence	M271_19390 - hypothetical protein (Protein is coded in complementary strand; from 4901831 to 4900950)