Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 488456
End position: 488491
Length: 36

DNA sequence
>NC_022785, from 488456 to 488491 (36 bp); Streptomyces rapamycinicus NRRL 5491 GAGTCGCTTCATGAGCCCCTTCATGAGTCGCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 487659-488492	Sequence	M271_01995 - ABC transporter permease (Protein is coded in complementary strand; from 488492 to 487659)
ORF... 488492-489271	Sequence	M271_02000 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 489271 to 488492)