Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4857549
End position: 4857593
Length: 45

DNA sequence
>NC_022785, from 4857549 to 4857593 (45 bp); Streptomyces rapamycinicus NRRL 5491 CCCCCGGAGGCGGAACCTCCGGATACGGAACCCGCGGACGCGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4856340-4857704	Sequence	M271_19160 - threonine dehydratase (Protein is coded in complementary strand; from 4857704 to 4856340)