Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4830590
End position: 4830625
Length: 36

DNA sequence
>NC_022785, from 4830590 to 4830625 (36 bp); Streptomyces rapamycinicus NRRL 5491 GGCCACCTGACGGGCCACCGGACCCGTCACCTGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4829881-4831743	Sequence	M271_19055 - peptide ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 4831743 to 4829881)