Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4804126
End position: 4804185
Length: 60

DNA sequence
>NC_022785, from 4804126 to 4804185 (60 bp); Streptomyces rapamycinicus NRRL 5491 GGGGCCTTGGCGGAGACCTTGGCGGGGGCCTCGGCAGGGGCCTTGACGGAGACCTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4803391-4804281	Sequence	M271_18935 - hypothetical protein (Protein is coded in complementary strand; from 4804281 to 4803391)