Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4791110
End position: 4791133
Length: 24

DNA sequence
>NC_022785, from 4791110 to 4791133 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGTGACGGTGGCGTTGACGGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4790820-4791401	Sequence	M271_18875 - hypothetical protein (Protein is coded in complementary strand; from 4791401 to 4790820)