Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4786334
End position: 4786358
Length: 25

DNA sequence
>NC_022785, from 4786334 to 4786358 (25 bp); Streptomyces rapamycinicus NRRL 5491 GCCGCGCCGAGCAGCGCCGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4786001-4786639	Sequence	M271_18850 - peptidase (Protein is coded in complementary strand; from 4786639 to 4786001)