Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4770683
End position: 4770718
Length: 36

DNA sequence
>NC_022785, from 4770683 to 4770718 (36 bp); Streptomyces rapamycinicus NRRL 5491 GCGCTCGACGACGCGCTGGACGACGGGCTGGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4770569-4772803	Sequence	M271_18785 - penicillin-binding protein (Protein is coded in complementary strand; from 4772803 to 4770569)