Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4690046
End position: 4690069
Length: 24

DNA sequence
>NC_022785, from 4690046 to 4690069 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCGTTGCCGGTGACGTTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4688979-4690586	Sequence	M271_18485 - amino acid:proton symporter (Protein is coded in complementary strand; from 4690586 to 4688979)