Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4646925
End position: 4646969
Length: 45

DNA sequence
>NC_022785, from 4646925 to 4646969 (45 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCACCGTAGCCACCGCCGCCGTAGCCCCCACCGCCATAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4646901-4648064	Sequence	M271_18300 - hypothetical protein (Protein is coded in complementary strand; from 4648064 to 4646901)