Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4638321
End position: 4638377
Length: 57

DNA sequence
>NC_022785, from 4638321 to 4638377 (57 bp); Streptomyces rapamycinicus NRRL 5491 GCGCTCACGCCTTACGGGTGCGCTCACTCCTTACGGCGTCCCTCACGCCTTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4638364-4639107	Sequence	M271_18270 - ABC transporter (Protein is coded in complementary strand; from 4639107 to 4638364)