Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4626582
End position: 4626626
Length: 45

DNA sequence
>NC_022785, from 4626582 to 4626626 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCCCTCGAAATCGCCGTCCTCGAAGCCGCCGTCCTCGAAACCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4626502-4627023	Sequence	M271_18210 - hypothetical protein (Protein is coded in complementary strand; from 4627023 to 4626502)