Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4621175
End position: 4621210
Length: 36

DNA sequence
>NC_022785, from 4621175 to 4621210 (36 bp); Streptomyces rapamycinicus NRRL 5491 GGCGCCTGGGGCGGCGTCTGGGGCGGTGCCTGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4619801-4621534	Sequence	M271_18170 - hypothetical protein (Protein is coded in complementary strand; from 4621534 to 4619801)