Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4597626
End position: 4597661
Length: 36

DNA sequence
>NC_022785, from 4597626 to 4597661 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCGGGACCACCGGGTCCACCGGGTCCACCGGGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4597574-4597735	Sequence	M271_18055 - hypothetical protein (Protein is coded in complementary strand; from 4597735 to 4597574)