Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4568173
End position: 4568196
Length: 24

DNA sequence
>NC_022785, from 4568173 to 4568196 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCGAGGACGAGCCCGAGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4566728-4568212	Sequence	M271_17960 - ABC transporter ATP-binding protein