Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4507105
End position: 4507137
Length: 33

DNA sequence
>NC_022785, from 4507105 to 4507137 (33 bp); Streptomyces rapamycinicus NRRL 5491 GTCTGCCTCAGGTGTGCCTCAGGTGTGCCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4507135-4508205	Sequence	M271_17685 - glucosamine-6-phosphate deaminase (Protein is coded in complementary strand; from 4508205 to 4507135)