Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4473085
End position: 4473120
Length: 36

DNA sequence
>NC_022785, from 4473085 to 4473120 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGGACTGGGGCTCGGACTGGGGCTCGGACTGGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4472332-4473450	Sequence	M271_17495 - PadR family transcriptional regulator