Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4435193
End position: 4435237
Length: 45

DNA sequence
>NC_022785, from 4435193 to 4435237 (45 bp); Streptomyces rapamycinicus NRRL 5491 GACGGAGCCGACGGAGCCGACGGAGCCGACGGAGCCGACGGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4434125-4437466	Sequence	M271_17345 - ATP-binding protein (Protein is coded in complementary strand; from 4437466 to 4434125)