Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4423668
End position: 4423703
Length: 36

DNA sequence
>NC_022785, from 4423668 to 4423703 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCCCGAGCCCGGCTCCGAGCCGGGTCCCGAGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4422536-4423726	Sequence	M271_17290 - transporter (Protein is coded in complementary strand; from 4423726 to 4422536)