Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4393947
End position: 4393990
Length: 44

DNA sequence
>NC_022785, from 4393947 to 4393990 (44 bp); Streptomyces rapamycinicus NRRL 5491 CTCGACCCGCCCTCTACTCGCCCTCTACTCGCCCTCGACCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4393972-4395264	Sequence	M271_17165 - homoserine dehydrogenase (Protein is coded in complementary strand; from 4395264 to 4393972)