Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4376245
End position: 4376268
Length: 24

DNA sequence
>NC_022785, from 4376245 to 4376268 (24 bp); Streptomyces rapamycinicus NRRL 5491 TCGAGGTTGAGGGCGAGGCCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4374886-4376457	Sequence	M271_17080 - F0F1 ATP synthase subunit alpha (Protein is coded in complementary strand; from 4376457 to 4374886)