Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4252238
End position: 4252261
Length: 24

DNA sequence
>NC_022785, from 4252238 to 4252261 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGCGATCGCGACCACGACCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4251469-4253163	Sequence	M271_16545 - membrane protein (Protein is coded in complementary strand; from 4253163 to 4251469)