Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4216496
End position: 4216561
Length: 66

DNA sequence
>NC_022785, from 4216496 to 4216561 (66 bp); Streptomyces rapamycinicus NRRL 5491 GCCCGGTACGCGAGGTGCGGCGGCTCAGTACGCGGGGCGCGGCGGCTCAGTACGCGGGGCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4216543-4217340	Sequence	M271_16375 - hypothetical protein (Protein is coded in complementary strand; from 4217340 to 4216543)