Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4207985
End position: 4208011
Length: 27

DNA sequence
>NC_022785, from 4207985 to 4208011 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGGTGGTGTGGGTGGTGTCGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4207693-4208586	Sequence	M271_16335 - toxin-antitoxin system toxin subunit (Protein is coded in complementary strand; from 4208586 to 4207693)