Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4193413
End position: 4193448
Length: 36

DNA sequence
>NC_022785, from 4193413 to 4193448 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGGACTCTTCCCCGGCCTCTTCCCCGGACTCTTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4193406-4195628	Sequence	M271_16280 - DNA ligase (Protein is coded in complementary strand; from 4195628 to 4193406)