Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4175048
End position: 4175071
Length: 24

DNA sequence
>NC_022785, from 4175048 to 4175071 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCCGGCCGACCGGCCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4174971-4175162	Sequence	M271_16215 - hypothetical protein (Protein is coded in complementary strand; from 4175162 to 4174971)