Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4165932
End position: 4165955
Length: 24

DNA sequence
>NC_022785, from 4165932 to 4165955 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCTGGAGCTGGGCCTGGAGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4164437-4167352	Sequence	M271_16190 - integral membrane phosphodiesterase (Protein is coded in complementary strand; from 4167352 to 4164437)