Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4157794
End position: 4157817
Length: 24

DNA sequence
>NC_022785, from 4157794 to 4157817 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGGGGTCGGCGTCGGGTTCGGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4157790-4158569	Sequence	M271_16165 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 4158569 to 4157790)