Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4148237
End position: 4148260
Length: 24

DNA sequence
>NC_022785, from 4148237 to 4148260 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCGGGGCCGCGGCCAGGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4146887-4148518	Sequence	M271_16130 - 1-pyrroline-5-carboxylate dehydrogenase (Protein is coded in complementary strand; from 4148518 to 4146887)