Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4087430
End position: 4087453
Length: 24

DNA sequence
>NC_022785, from 4087430 to 4087453 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGCGGTCGCGGCCGGGGCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4086454-4087671	Sequence	M271_15815 - cell division protein FtsY (Protein is coded in complementary strand; from 4087671 to 4086454)