Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4081771
End position: 4081794
Length: 24

DNA sequence
>NC_022785, from 4081771 to 4081794 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGCAGCCGCGCCGCCGCGTAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4079272-4081845	Sequence	M271_15790 - PII uridylyl-transferase (Protein is coded in complementary strand; from 4081845 to 4079272)