Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4077483
End position: 4077509
Length: 27

DNA sequence
>NC_022785, from 4077483 to 4077509 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCCGGCATCCCGGGCATCCCCGGCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4077270-4078817	Sequence	M271_15785 - signal recognition particle (Protein is coded in complementary strand; from 4078817 to 4077270)