Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4066839
End position: 4066863
Length: 25

DNA sequence
>NC_022785, from 4066839 to 4066863 (25 bp); Streptomyces rapamycinicus NRRL 5491 GTCCGCTCCGGTCCGCTCCGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4066351-4066881	Sequence	M271_15720 - mutator MutT protein (Protein is coded in complementary strand; from 4066881 to 4066351)