Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4051895
End position: 4051918
Length: 24

DNA sequence
>NC_022785, from 4051895 to 4051918 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGCGGCGGCGGCCACGGCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4050840-4052570	Sequence	M271_15650 - iron ABC transporter permease (Protein is coded in complementary strand; from 4052570 to 4050840)