Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 4037485
End position: 4037517
Length: 33

DNA sequence
>NC_022785, from 4037485 to 4037517 (33 bp); Streptomyces rapamycinicus NRRL 5491 GGAATCAGCCCGGCGTCAGCCCGGCATCAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4037512-4038963	Sequence	M271_15610 - gamma-aminobutyraldehyde dehydrogenase (Protein is coded in complementary strand; from 4038963 to 4037512)