Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 39704
End position: 39728
Length: 25

DNA sequence
>NC_022785, from 39704 to 39728 (25 bp); Streptomyces rapamycinicus NRRL 5491 GGGGGGCGGGGTGGGCGGGGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 39180-39977	Sequence	M271_00170 - hypothetical protein (Protein is coded in complementary strand; from 39977 to 39180)