Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3867497
End position: 3867550
Length: 54

DNA sequence
>NC_022785, from 3867497 to 3867550 (54 bp); Streptomyces rapamycinicus NRRL 5491 CCCGGCCCCTGCGGCACGCCCCACCCTTGCGGCACGCCCGGCCCCTGCGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3867018-3868742	Sequence	M271_14980 - 2,4-diaminobutyrate 4-aminotransferase (Protein is coded in complementary strand; from 3868742 to 3867018)