Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3855786
End position: 3855809
Length: 24

DNA sequence
>NC_022785, from 3855786 to 3855809 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGGCCGCGGTCGCCGCCGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3855217-3855843	Sequence	M271_14940 - TetR family transcriptional regulator