Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3843003
End position: 3843032
Length: 30

DNA sequence
>NC_022785, from 3843003 to 3843032 (30 bp); Streptomyces rapamycinicus NRRL 5491 GCGGGAGCGGGAGCGGGAGCGGGAGCGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3841851-3844118	Sequence	M271_14890 - ABC transporter (Protein is coded in complementary strand; from 3844118 to 3841851)